ID: 951864229_951864231

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 951864229 951864231
Species Human (GRCh38) Human (GRCh38)
Location 3:27289341-27289363 3:27289361-27289383
Sequence CCATTTGTTTTGCTTCTGCCTGC TGCCACTACCTCCTCCTTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 544} {0: 1, 1: 0, 2: 1, 3: 26, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!