ID: 951955574_951955577

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 951955574 951955577
Species Human (GRCh38) Human (GRCh38)
Location 3:28249661-28249683 3:28249683-28249705
Sequence CCTCTCAGGTGGTTCTTGGGTAC CAGCCAGGGTTGAGAGCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 79} {0: 1, 1: 0, 2: 9, 3: 98, 4: 404}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!