ID: 951965674_951965681

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 951965674 951965681
Species Human (GRCh38) Human (GRCh38)
Location 3:28381912-28381934 3:28381933-28381955
Sequence CCCAGCAATAGGAGGCCAAGGTG TGGGCGGATCACCTGAGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 34, 3: 171, 4: 578} {0: 6256, 1: 38634, 2: 78388, 3: 109169, 4: 111926}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!