|
Left Crispr |
Right Crispr |
| Crispr ID |
952057966 |
952057969 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:29473013-29473035
|
3:29473049-29473071
|
| Sequence |
CCCATCAGAGTAGCTAGATACAG |
GCATTCACAAACCTTGAGCTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 695, 2: 1761, 3: 1153, 4: 946} |
{0: 1, 1: 21, 2: 20, 3: 63, 4: 190} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|