ID: 952149115_952149117

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 952149115 952149117
Species Human (GRCh38) Human (GRCh38)
Location 3:30567280-30567302 3:30567314-30567336
Sequence CCTGTTAGAGCAGAAAGAAAAAC CAGCTGACACCCACCCATAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!