ID: 952178347_952178351

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 952178347 952178351
Species Human (GRCh38) Human (GRCh38)
Location 3:30891504-30891526 3:30891518-30891540
Sequence CCAGGTCACTGGCCCATATTCTG CATATTCTGTAACATAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 146} {0: 1, 1: 0, 2: 2, 3: 8, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!