ID: 952337822_952337826

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 952337822 952337826
Species Human (GRCh38) Human (GRCh38)
Location 3:32420390-32420412 3:32420413-32420435
Sequence CCAGCCTAACAGGTTATTTTTAA AAAGTGAAGCCCAATGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 80, 4: 738} {0: 1, 1: 0, 2: 4, 3: 20, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!