ID: 952348488_952348491

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 952348488 952348491
Species Human (GRCh38) Human (GRCh38)
Location 3:32511256-32511278 3:32511282-32511304
Sequence CCTCTCCAACACTGTGGTCAAGC TGAATTTTTTTCATTCTGATAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 10, 3: 134, 4: 1195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!