ID: 952442790_952442795

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 952442790 952442795
Species Human (GRCh38) Human (GRCh38)
Location 3:33349909-33349931 3:33349927-33349949
Sequence CCAAAACAGAAAGCACCAGACCC GACCCGGATGGTGGTTTTACTGG
Strand - +
Off-target summary {0: 5, 1: 27, 2: 110, 3: 140, 4: 446} {0: 1, 1: 0, 2: 0, 3: 6, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!