ID: 952492867_952492876

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 952492867 952492876
Species Human (GRCh38) Human (GRCh38)
Location 3:33888538-33888560 3:33888556-33888578
Sequence CCAAGGAGTCAGACAGGGCCCTA CCCTATGGTGGGGGCCTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 163} {0: 1, 1: 0, 2: 1, 3: 19, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!