ID: 952720466_952720471

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 952720466 952720471
Species Human (GRCh38) Human (GRCh38)
Location 3:36526915-36526937 3:36526928-36526950
Sequence CCTTGCTACAGCTATTAGGATAG ATTAGGATAGGAGGAGGAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104} {0: 1, 1: 0, 2: 7, 3: 132, 4: 1279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!