ID: 952752836_952752844

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 952752836 952752844
Species Human (GRCh38) Human (GRCh38)
Location 3:36839396-36839418 3:36839438-36839460
Sequence CCAGCATGTACACATTAGGTCTC CTAAGTGGCACATGCTGATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 68} {0: 1, 1: 0, 2: 0, 3: 14, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!