ID: 952753226_952753231

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 952753226 952753231
Species Human (GRCh38) Human (GRCh38)
Location 3:36842621-36842643 3:36842661-36842683
Sequence CCTTCCAGCACTGGTGCTTGGCG AATCCACTCCGCAGGAGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 184} {0: 1, 1: 0, 2: 0, 3: 3, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!