ID: 952760339_952760342

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 952760339 952760342
Species Human (GRCh38) Human (GRCh38)
Location 3:36907964-36907986 3:36907978-36908000
Sequence CCCGGCGGGGTGTGCGCTGTGGC CGCTGTGGCCACGGAGTAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 190} {0: 1, 1: 0, 2: 0, 3: 8, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!