ID: 952816968_952816978

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 952816968 952816978
Species Human (GRCh38) Human (GRCh38)
Location 3:37454047-37454069 3:37454079-37454101
Sequence CCAGATCCCCACACTAGGCACCA GAAGCACTGTCAAAAATGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 167} {0: 1, 1: 0, 2: 0, 3: 13, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!