ID: 952867191_952867208

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 952867191 952867208
Species Human (GRCh38) Human (GRCh38)
Location 3:37862003-37862025 3:37862048-37862070
Sequence CCCAGCGGCGGCGGCGGCGGGAG CTCTCCCAGAGCGCGGGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 30, 3: 201, 4: 656} {0: 1, 1: 0, 2: 1, 3: 21, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!