ID: 952880216_952880221

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 952880216 952880221
Species Human (GRCh38) Human (GRCh38)
Location 3:37980711-37980733 3:37980737-37980759
Sequence CCTGCTGCCTCCTCCATGCACTG TCCAGGTGCCTGTGCAGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 65, 4: 498} {0: 1, 1: 1, 2: 2, 3: 22, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!