ID: 952880216_952880224

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 952880216 952880224
Species Human (GRCh38) Human (GRCh38)
Location 3:37980711-37980733 3:37980753-37980775
Sequence CCTGCTGCCTCCTCCATGCACTG GTCCTGGTTCGATGACATGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 65, 4: 498} {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!