ID: 952895998_952896007

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 952895998 952896007
Species Human (GRCh38) Human (GRCh38)
Location 3:38079478-38079500 3:38079503-38079525
Sequence CCAAAGCTCGGTGTCCGTGATGG TAGGGGGCTTTGGAGGCGATCGG
Strand - +
Off-target summary {0: 9, 1: 80, 2: 113, 3: 62, 4: 73} {0: 1, 1: 2, 2: 116, 3: 173, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!