ID: 952911442_952911446

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 952911442 952911446
Species Human (GRCh38) Human (GRCh38)
Location 3:38191520-38191542 3:38191569-38191591
Sequence CCTCTATTTCTTGTATATTGAAA CAGGTTAAATATTTTGTAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 498} {0: 1, 1: 0, 2: 0, 3: 17, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!