ID: 952925261_952925273

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 952925261 952925273
Species Human (GRCh38) Human (GRCh38)
Location 3:38315452-38315474 3:38315491-38315513
Sequence CCTGAGCCTGCTGGCCAGCTGGG CTGTTCAGATGCCTTCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 248, 4: 8367} {0: 1, 1: 0, 2: 0, 3: 19, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!