ID: 952961996_952962003

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 952961996 952962003
Species Human (GRCh38) Human (GRCh38)
Location 3:38598168-38598190 3:38598186-38598208
Sequence CCATAGGGACAGGAAACAAAGAT AAGATGGAGGTGGGGAAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 273} {0: 1, 1: 1, 2: 6, 3: 67, 4: 570}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!