ID: 952967563_952967564

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 952967563 952967564
Species Human (GRCh38) Human (GRCh38)
Location 3:38630713-38630735 3:38630726-38630748
Sequence CCAGCTGTTGTCACAGCAGAGGC CAGCAGAGGCTCAGCAGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 216} {0: 1, 1: 0, 2: 3, 3: 33, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!