ID: 952978184_952978193

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 952978184 952978193
Species Human (GRCh38) Human (GRCh38)
Location 3:38713965-38713987 3:38714006-38714028
Sequence CCTTCAAATCGAGAAAGAGCCCG AAGGGTTCGAAGGGCTTTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57} {0: 1, 1: 0, 2: 0, 3: 12, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!