ID: 952979560_952979569

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 952979560 952979569
Species Human (GRCh38) Human (GRCh38)
Location 3:38723734-38723756 3:38723782-38723804
Sequence CCCTGATGGAGTGCTGGCAATGG AACGACTCTCAGCATTCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 136} {0: 1, 1: 0, 2: 0, 3: 3, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!