ID: 953043730_953043741

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 953043730 953043741
Species Human (GRCh38) Human (GRCh38)
Location 3:39277506-39277528 3:39277549-39277571
Sequence CCCTCCTTGTTCAGCTCCTCCAT GTCTCTGGACTCAGGATACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 395} {0: 1, 1: 0, 2: 2, 3: 12, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!