ID: 953100487_953100489

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 953100487 953100489
Species Human (GRCh38) Human (GRCh38)
Location 3:39820931-39820953 3:39820944-39820966
Sequence CCATCCACTTTCTGCTTGGGTTG GCTTGGGTTGCTTTTCCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 297} {0: 1, 1: 0, 2: 5, 3: 33, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!