ID: 953109730_953109737

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 953109730 953109737
Species Human (GRCh38) Human (GRCh38)
Location 3:39922316-39922338 3:39922352-39922374
Sequence CCAAACGACACAGAAAAAAATCT CTACCTAGAAAAAGCTAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 644} {0: 1, 1: 0, 2: 0, 3: 12, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!