ID: 953121518_953121525

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 953121518 953121525
Species Human (GRCh38) Human (GRCh38)
Location 3:40047392-40047414 3:40047432-40047454
Sequence CCTGGAAAGACATGCAACAGCCA TTTTATTTTAAGAAAGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 210} {0: 1, 1: 0, 2: 11, 3: 83, 4: 953}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!