ID: 953132037_953132044

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 953132037 953132044
Species Human (GRCh38) Human (GRCh38)
Location 3:40149375-40149397 3:40149391-40149413
Sequence CCCAAACACCTTCCACCAGGCCC CAGGCCCACCTCTAGCATTGGGG
Strand - +
Off-target summary {0: 32, 1: 408, 2: 1041, 3: 1765, 4: 2028} {0: 1, 1: 5, 2: 26, 3: 135, 4: 627}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!