ID: 953137359_953137361

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 953137359 953137361
Species Human (GRCh38) Human (GRCh38)
Location 3:40192882-40192904 3:40192916-40192938
Sequence CCATCATGCTTCTACATAGTAAC ATGCAGAATAAGCTCCTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 112} {0: 1, 1: 3, 2: 6, 3: 22, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!