ID: 953246561_953246571

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 953246561 953246571
Species Human (GRCh38) Human (GRCh38)
Location 3:41199279-41199301 3:41199308-41199330
Sequence CCAGCCGTCACCCCGGGGAGCGT GGTGCCCAGGCACCCCACCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69} {0: 1, 1: 0, 2: 6, 3: 45, 4: 758}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!