ID: 953311437_953311440

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 953311437 953311440
Species Human (GRCh38) Human (GRCh38)
Location 3:41883948-41883970 3:41883971-41883993
Sequence CCCGTCTGTAAATGGAGAGAAAA CAGGCTCTGAAAAGAAGAGTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 52, 4: 471} {0: 1, 1: 0, 2: 5, 3: 24, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!