ID: 953341810_953341815

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 953341810 953341815
Species Human (GRCh38) Human (GRCh38)
Location 3:42140756-42140778 3:42140770-42140792
Sequence CCCCTCAAGGACGGAAGGTTAGG AAGGTTAGGAAGCCTCTTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 38} {0: 1, 1: 0, 2: 0, 3: 14, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!