ID: 953344749_953344751

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 953344749 953344751
Species Human (GRCh38) Human (GRCh38)
Location 3:42165875-42165897 3:42165888-42165910
Sequence CCTAATAGTGGGGTACCAGCATC TACCAGCATCACCCCAAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 74} {0: 1, 1: 0, 2: 3, 3: 12, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!