ID: 953421548_953421557

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 953421548 953421557
Species Human (GRCh38) Human (GRCh38)
Location 3:42757214-42757236 3:42757249-42757271
Sequence CCTACAAGGCAAAGGCAGAATTA GGCAAAGGCCCTGGTGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 289} {0: 1, 1: 1, 2: 1, 3: 47, 4: 396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!