ID: 953503148_953503152

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 953503148 953503152
Species Human (GRCh38) Human (GRCh38)
Location 3:43457603-43457625 3:43457624-43457646
Sequence CCTCCCTCAATATGTGGGAATTA TACAATTCAAGATGAGATTTGGG
Strand - +
Off-target summary {0: 1, 1: 82, 2: 1133, 3: 3449, 4: 6024} {0: 6802, 1: 10434, 2: 9513, 3: 7783, 4: 4679}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!