ID: 953506505_953506512

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 953506505 953506512
Species Human (GRCh38) Human (GRCh38)
Location 3:43490954-43490976 3:43490993-43491015
Sequence CCCGATAAGATCTCAGGAGTTGG ATGCATATTAAGAGGCAGAATGG
Strand - +
Off-target summary {0: 124, 1: 276, 2: 289, 3: 244, 4: 222} {0: 1, 1: 7, 2: 57, 3: 192, 4: 570}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!