ID: 953599411_953599419

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 953599411 953599419
Species Human (GRCh38) Human (GRCh38)
Location 3:44348364-44348386 3:44348396-44348418
Sequence CCGGGCAAGTTGGACAGTCCGAT GGTCCCACACAGATGGGACACGG
Strand - +
Off-target summary {0: 3, 1: 12, 2: 78, 3: 387, 4: 335} {0: 82, 1: 298, 2: 258, 3: 133, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!