ID: 953610421_953610428

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 953610421 953610428
Species Human (GRCh38) Human (GRCh38)
Location 3:44443150-44443172 3:44443173-44443195
Sequence CCAGGTGAAGGGAGGCAGCACAA GGCAGAACACTCTGGGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 199} {0: 1, 1: 0, 2: 0, 3: 13, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!