ID: 953643559_953643566

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 953643559 953643566
Species Human (GRCh38) Human (GRCh38)
Location 3:44731644-44731666 3:44731678-44731700
Sequence CCACCAATGTCCACTAAATGTGG AATGCAGGACCACACAGAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83} {0: 1, 1: 0, 2: 2, 3: 28, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!