ID: 953731373_953731376

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 953731373 953731376
Species Human (GRCh38) Human (GRCh38)
Location 3:45451862-45451884 3:45451914-45451936
Sequence CCTTTTCAATTACTATCATCAAT CCTTGCTTAAATTTACTCCTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 24, 3: 255, 4: 1109} {0: 1, 1: 11, 2: 190, 3: 620, 4: 1336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!