ID: 953787333_953787341

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 953787333 953787341
Species Human (GRCh38) Human (GRCh38)
Location 3:45921143-45921165 3:45921174-45921196
Sequence CCCTCCAACACTGCTGAGTTCTG TCCAGCTTACTGGGGCAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 288} {0: 1, 1: 0, 2: 0, 3: 15, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!