ID: 953788525_953788543

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 953788525 953788543
Species Human (GRCh38) Human (GRCh38)
Location 3:45929228-45929250 3:45929271-45929293
Sequence CCTTCTGCCCCCTGGTGTCACTG CCCTGGAAGCTAGAGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 319} {0: 1, 1: 0, 2: 2, 3: 43, 4: 528}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!