ID: 953818118_953818123

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 953818118 953818123
Species Human (GRCh38) Human (GRCh38)
Location 3:46179248-46179270 3:46179295-46179317
Sequence CCCAGGATATTGTCAATTTTGGT ATGTGAATTCTGCTGTTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 22, 3: 124, 4: 2363} {0: 1, 1: 4, 2: 73, 3: 368, 4: 1261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!