ID: 953861743_953861749

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 953861743 953861749
Species Human (GRCh38) Human (GRCh38)
Location 3:46550201-46550223 3:46550216-46550238
Sequence CCTAAGTCCCAACTTCCTCATCT CCTCATCTGCAAATTAGGGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 17, 3: 119, 4: 759} {0: 1, 1: 0, 2: 16, 3: 115, 4: 513}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!