ID: 953883725_953883736

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 953883725 953883736
Species Human (GRCh38) Human (GRCh38)
Location 3:46704347-46704369 3:46704395-46704417
Sequence CCTAGACACCCAAGGTGGACCAT TGTCCCCTAGAGACCCAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 2, 3: 10, 4: 91} {0: 1, 1: 4, 2: 3, 3: 18, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!