ID: 953890878_953890891

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 953890878 953890891
Species Human (GRCh38) Human (GRCh38)
Location 3:46750790-46750812 3:46750815-46750837
Sequence CCCCACGCCCGGCCATGAGGCTG GGGTCGAGGCCATGAGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 132} {0: 1, 1: 0, 2: 0, 3: 27, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!