ID: 953912405_953912411

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 953912405 953912411
Species Human (GRCh38) Human (GRCh38)
Location 3:46899642-46899664 3:46899674-46899696
Sequence CCAGGGATCAGGTTCACCTGAGG CCTGAATTGAGGCTCGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 178} {0: 1, 1: 0, 2: 0, 3: 12, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!