ID: 953923449_953923454

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 953923449 953923454
Species Human (GRCh38) Human (GRCh38)
Location 3:46967717-46967739 3:46967742-46967764
Sequence CCCCAGGGCCTGTCATACAGCTG ACTCAATAAATACTTATTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 281} {0: 1, 1: 1, 2: 9, 3: 75, 4: 556}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!